Overblog
Suivre ce blog Administration + Créer mon blog
Corps en Immersion

Une actualité dans les arts et les sciences à travers les corps pluriels.

Paléo-art : la biodiversité du futur

Publié le 30 Janvier 2018 par Anaïs BERNARD dans conférence

Paléo-art : la biodiversité du futur

Mardi 30 janvier 2018 à 19h
Cité des sciences et de l'industrie, Paris

Pour composer des visions du monde neuves et personnelles, les artistes s’imprègnent des connaissances de leur temps. Leurs oeuvres enregistrent les évolutions et révolutions scientifiques, que permettent par exemple l’exploration cérébrale, l’étude de l’activité cellulaire et les progrès de la paléontologie.
Découvrons ces nouvelles représentations chez quelques artistes d’aujourd’hui.

Aujourd'hui, la conférence portera sur Paléo-art : la biodiversité du futur.
L’étude des animaux du passé nous renseigne sur notre biodiversité et permet d’imaginer un futur. Quelles plantes et quels animaux se développeront sur Terre après la disparition de l’être humain ? Embarquez pour un voyage temporel entre art et science et réfléchissez sur le rôle de l’Homme au sein de la biodiversité, en imaginant des évolutions possibles dans 10 millions d’années.

Avec Marc Boulay, paléoartiste, sculpteur animalier, sculpteur numérique, directeur artistique de l’Agence Cossima Productions ; Jean-Sébastien Steyer, paléontologue au CNRS, Centre de recherche sur la paléobiodiversité et les paléoenvironnements, MNHN.

commentaires

La technologie prêt-à-porter

Publié le 30 Janvier 2018 par Anaïs BERNARD dans exposit

La technologie prêt-à-porter

L’exposition La technologie prêt-à-porter aborde les technologies destinées au corps. Des montres intelligentes et caméras de surveillance aux stimulateurs cardiaques et dispositifs de localisation d’animaux de compagnie, cette exposition présente un éventail d’innovations remarquables remontant parfois aux années 1800. Les visiteurs y découvrent les matériaux et fonctions de nombreuses technologies prêt-à-porter inattendues, dont certaines sont des prédécesseurs des dispositifs intelligents d’aujourd’hui, et d’autres ouvrent la voie aux technologies prêt-à-porter de demain. Ils peuvent ainsi faire l’essai d’un casque de hockey muni d’un détecteur de commotions cérébrales, écouter des sons enregistrés par des capteurs de sons fixés aux baleines, lire une micropuce implantée dans un chat et mesurer leur habileté à suivre le rythme d’un stimulateur cardiaque.

 

Cette exposition est à longue durée et peut être vue au Musée des sciences et de la technologie du Canada, situé au 1867, boul. Saint-Laurent, à quelques minutes du centre-ville d’Ottawa.

commentaires

Forum Européen de Bioéthique #8 Produire ou se reproduire?

Publié le 29 Janvier 2018 par Anaïs BERNARD dans evenement

Forum Européen de Bioéthique #8 Produire ou se reproduire?

Vivons-nous les dernières générations d’une reproduction à l’ancienne, dite naturelle ?
D’ailleurs peut-on seulement se « reproduire » ? Existe-t-il un lien entre notre civilisation du marché et de la performance et l’évolution rapide de la médicalisation de la procréation dans toutes les sociétés développées de la planète ? Dans notre monde où les temples sont peu à peu désertés et où les supermarchés n’arrivent guère à les remplacer, la sacralité, attribuée autrefois de manière inconsciente à la succession des générations, pourrait bien succomber sous les impératifs de la rentabilité à tous crins.

Les biotechnologies sont là. Leur avancée ne se fait pas sur le mode d’une croissance habituelle mais bel et bien, ce qui est inédit et nous fait sous-estimer les enjeux, sur une courbe exponentielle. Les technologies se fécondent les unes les autres :
les nanotechnologies sont renforcées par l’informatique et la génétique embrasse goulûment l’essor des sciences cognitives. Cette convergence pourrait amener des arguments de plus en plus forts pour ne plus laisser le hasard sévir et altérer parfois la santé de nos enfants. Homo sapiens est « addict » de la maîtrise et celle de sa reproduction n’échappera pas à son ingéniosité. Au début pour de bonnes raisons, bien médicales et bien justifiées : éviter par exemple la transmission d’une maladie héréditaire, puis pour de moins bonnes raisons : améliorer les performances intellectuelles et sportives de nos enfants, voire pire encore.

 

Les biotechnologies sont là et elles se fécondent les unes les autres.
À l’heure où des laboratoires de biologie de la reproduction sont en train de fabriquer des ovules à partir des cellules de peau d’un homme et vice versa, à l’heure du copier-coller efficace et précis sur le génome et au moment où les États rivalisent d’ingéniosité pour disposer des meilleurs cerveaux et augmenter le nombre de leurs brevets pour mieux dominer le monde, tout concorde pour qu’on puisse prédire que les découvertes n’auront pas le temps de refroidir avant d’être essayées voire mises en œuvre. Et les comités d’éthique n’y pourront rien. Ils avaliseront d’autant plus vite les innovations biotechnologiques qu’elles constitueront dans un premier temps de réelles avancées médicales et que leurs retombées financières présumées seront susceptibles d’être importantes, plus tard. La reproduction pourrait donc se voir assignée à efficience par les règles de la production et du marché. Bien se reproduire pour fabriquer de bons producteurs et reproducteurs.

Ces thèmes sont dérangeants et c’est bien pourquoi le Forum Européen de Bioéthique décide cette année de s’en emparer en invitant les meilleurs spécialistes français et européens pour nous expliquer simplement où nous en sommes de ces découvertes et ce qu’il y a dans les cartons des chercheurs. D’autres sujets de l’actualité bioéthique seront aussi abordés et de nombreuses manières nouvelles de présenter les enjeux de la bioéthique seront inaugurées cette année, grâce au rajeunissement des cadres entrepris dans l’organisation du Forum. Permettre aux plus jeunes de participer aux débats, c’est la raison pour laquelle le Forum se poursuivra cette année jusqu’au dimanche inclus.

 

La reproduction pourrait donc se voir assignée à efficience par les règles de la production et du marché. Bien se reproduire pour fabriquer de bons producteurs et reproducteurs.
Prendre le temps de comprendre pour appliquer notre jugement individuel à ces perspectives qui concernent nos enfants et nos petits-enfants ne nous donnera pas forcément le pouvoir de modifier l’avenir. Mais que peut-on espérer de mieux d’une société que la lucidité devant ce qui se profile pour son propre avenir ? Le progrès scientifique n’est pas toujours un progrès pour l’homme. Poser les questions de ce que sera notre futur sans toutefois disposer toujours de réponses valables, un exercice difficile qui nécessite une grande maturité dont a fait preuve, au fil des sept années précédentes, le public du Forum Européen de Bioéthique.

Un millésime qui s’annonce donc aussi exceptionnel que les précédents qui pourra être suivi en direct sur internet mais aussi sur place (dans la grande salle de l’Aubette, place Kléber à Strasbourg du 30 janvier au 4 février 2018) dans une ambiance de débat et de respect mutuel qui a toujours été la marque de fabrique et la caractéristique du Forum Européen de Bioéthique.

Le Forum 2018 arrive et sera, comme à l’accoutumée, un grand moment pour la ville de Strasbourg, l’Eurométropole et la Région Grand Est qui ont toujours soutenu sans réserve cette manifestation unique en Europe, car elle contribue désormais à notre rayonnement collectif.

commentaires

Future Love. Desire and Kinship in Hypernature

Publié le 28 Janvier 2018 par Anaïs BERNARD dans exposit

Pinar Yoldas, Kassandra TCGACTTGATGAACTCTCTACCACACT, 2017, Screenshot

Pinar Yoldas, Kassandra TCGACTTGATGAACTCTCTACCACACT, 2017, Screenshot

Exposition
18.01.2018 - 15.04.2018

Désir et filiation dans l’hypernature

L’exposition collective "Future Love. Desire and Kinship in Hypernature" examine l’impact des nouvelles technologies et des réseaux sociaux sur nos relations affectives et notre sexualité.

Pinar Yoldas, Kassandra TCGACTTGATGAACTCTCTACCACACT, 2017, Screenshot

Jamais l’avenir de nos relations affectives, sexuelles et familiales n’a semblé plus excitant, prometteur et tourmenté qu’aujourd’hui. Les biotechnologies offrent des moyens de reproduction alternatifs, qui transforment les rôles de genre et leurs frontières biologiques, tout en interrogeant les structures traditionnelles des liens familiaux. De nouveaux produits industriels proposent de réaliser des fantasmes sexuels atypiques, que ce soit dans le monde virtuel ou dans la réalité. La connectivité universelle permet aux modèles d’amour et de sexualité non conventionnels de circuler, soulevant ainsi perpétuellement des débats idéologiques parmi puritains et progressistes, malgré une acceptation croissante de la part de la population. Cette nouvelle interdépendance entre technologie, ingénierie et environnement donne naissance au concept d’«hypernature», une version améliorée de l’écosystème, incluant les corps artificiels et leurs corrélations. Dans ce contexte, certaines des théories les plus avant-gardistes remettent en question notre rôle prédominant dans l’écosphère, nous incitant à transcender les discours habituels sur l’Anthropocène, tout en examinant nos instincts impérieux de reproduction et de survie.

Ce débat nous incite à repenser nos identités et nos comportements. Les récents progrès des nouvelles technologies et des réseaux sociaux ont-ils fondamentalement modifié nos relations et nos sexualités? Quelle influence exercent-ils sur nos représentations de l’amour, de la famille et des rôles de genre? Dans un contexte post-numérique, les artistes internationaux qui participent à l’exposition abordent ces questions à travers une multitude de supports, depuis les biotechnologies jusqu’à la réalité virtuelle. Ils matérialisent différentes visions personnelles relatives à nos préférences sexuelles et amoureuses actuelles, considérant à cet égard les aspects liés non seulement aux histoires d’amour personnelles, mais également à la sexualité comme signe d’affection, comme processus reproductif ou comme activité récréative. Ainsi, Tabita Rezaire imagine des installations vidéo qui mélangent des éléments de la culture africaine traditionnelle et du cyberfuturisme, afin de générer des mantras thérapeutiques qui renversent les positions patriarcales occidentales sur la sexualité, tandis que les animations étincelantes de Wong Ping abordent le thème de la répression et de la frustration sexuelles. Una Szeemann produit des sculptures imprimées en 3D qui sont le fruit de ses méditations sous hypnose sur l’amour moderne, à l’ère des applications de rencontres. Le collectif !Mediengruppe Bitnik dévoile quant à lui le mécanisme cynique qui sous-tend précisément ce type de services virtuels. L’artiste et activiste Micha Cardenas a mis au point des applications spécifiquement conçues pour les personnes transgenres, afin de combler une lacune sur un marché lourdement déterminé par les modèles hétéronormés. Parallèlement, Mary Maggic crée des documentaires de fiction décrivant des protocoles maison de piratage d’œstrogènes, afin de soulever la question de l’accès des personnes trans et des femmes à ces hormones. Certains artistes, tels que Pinar Yoldas et Špela Petrič, émettent des hypothèses sur les biotechnologies et la possibilité de donner naissance à des enfants sur mesure, voire à de nouvelles espèces. Les travaux de Dmitry Morozov (alias ::vtol::) et Karen Lancel & Hermen Maat explorent le bio-feedback et les dispositifs portables comme moyens d’enregistrer, d’analyser et, potentiellement, d’améliorer nos comportements sexuels. Les œuvres de réalité virtuelle, comme celles d’Ed Fornieles, permettent de faire l’expérience de rencontres troublantes avec des partenaires inattendus. Enfin, les installations combinées de Joey Holder, Chloé Delarue et Olga Fedorova donnent forme à des représentations visionnaires et emblématiques de notre sexualité moderne perturbée. 

L’exposition "Future Love. Desire and Kinship in Hypernature" livre des points de vue critiques, insolites et novateurs sur notre vie dans le futur, ainsi que sur les changements, les opportunités et les défis imminents, susceptibles d’influencer nos comportements. Les œuvres présentées constituent des hypothèses, des critiques et, parfois, des utopies, qui nous invitent à examiner les modèles de relations affectives qui définissent notre condition d’êtres humains et notre présence dans l’écosphère.

Artistes: Micha Cárdenas (US), Chloé Delarue (CH), Olga Fedorova (RU), Ed Fornieles (UK), Joey Holder (UK), Karen Lancel & Hermen Maat (NL), Dmitry Morozov (RU), Špela Petrič (SI), Wong Ping (HK), Tabita Rezaire (FR), Una Szeemann (CH), Mary Maggic (US), Pinar Yoldas (TR/US), !Mediengruppe Bitnik (CH).

Commissaire d’exposition: Boris Magrini

Vernissage: 17.01.2017, 19:00

commentaires

La science se livre 2018

Publié le 27 Janvier 2018 par Anaïs BERNARD dans conférence, exposit, evenement

La science se livre 2018

La science se livre 2018 - le numérique
du samedi 27 janvier au samedi 17 février

Initié par le Département des Hauts-de-Seine, « La science se livre » vise à développer des animations de culture scientifique, favoriser les échanges avec la communauté scientifique et le public, et proposer des formations aux professionnels. Pendant trois semaines, le public peut ainsi profiter de 150 animations scientifiques sous la forme d’expositions, projections et ateliers à travers tout le département des Hauts-de-Seine. 

Pour la 5ème année consécutive, Le Cube participe à cet événement dont la thématique 2018 est : « Le numérique » ! Vous voulez mieux comprendre les enjeux sociaux, culturels, politiques, environnementaux, économiques, juridiques et éthiques qui accompagnent la diffusion des sciences et des nouvelles technologies dans notre société en pleine mutation ? « La science se livre » encourage la diffusion d’une culture numérique éclairée, en mettant à l’honneur les sciences numériques et les sciences du numérique. 

« La science se livre » au Cube, c’est :

Du 27 janvier au 17 février : « Swap Tales : Léon ! », exposition
Vendredi 2 février à 19h : « Soirée Créative Books », Book jam et remise des prix
Jeudi 15 février 20h30 : « Toystroy », concert
Samedi 17 février 14h30 : « Initiation au circuit bending », workshop créatif de Toystroy

commentaires

Sors de ce corps !

Publié le 26 Janvier 2018 par Anaïs BERNARD dans festivals

© Papierski Edouard - Collectif INVIVO

© Papierski Edouard - Collectif INVIVO

Festival Sors de ce corps !
du 2 au 11 février


Némo et la Gaîté se rejoignent pour une exploration captivante des mutations de la scène, des musiques et des arts visuels à l’âge du numérique. Venez vivre une nouvelle expérience de spectateur !
La Biennale Némo et la Gaîté Lyrique se rejoignent pour ce premier pas d'une exploration au long cours des mutations de la scène, des musiques et des arts visuels.

Le festival Sors de ce corps ! propose pendant 10 jours un choix d'expériences et d'explorations dédiées aux mutations de l’espace de la représentation à l'ère technologique. Toutes interrogent le corps, absent ou présent, connecté ou dématérialisé, augmenté ou asservi par la technologie. Toutes remettent en jeu le protocole de la représentation et les chemins de la sensation, qu’il s’agisse de théâtre, de musique ou d’arts visuels. Les étiquettes valsent.

Nous pourrions théoriser à l’infini les œuvres qui composent ce programme (spectacle vivant post-médiatique, réalités mixtes, performativité machinique, mobilité du spectateur et virtualité de l’acteur...), mais nous vous proposons simplement d’en vivre l’expérience et de vous hybrider en elles.

Vous serez assis ou allongés, vous danserez, vous serez immergé seul ou en groupe, vous conduirez votre stratégie d’écoute, vous chuterez dans le temps musical, vous dealerez votre sommeil et vos yeux, vous serez emportés par une euphorie polychromatique de sons et d’images. Sors de ce corps! vous invite à faire l’expérience de ce décentrement exaltant, vertigineux, de l’écoute et du regard. 

Spectacles
Artefact par Joris Mathieu
Témoignage d’un homme qui n'avait pas envie d'en castrer un autre par Thibaud Croisy
24 / 7 par le Collectif INVIVO
DCOD’R et Ykimnar par Collectif GK
For Morton Feldman par Halory Goerger
Ergonomics par Rocia Berenguer et Marja Freigang
Présages par Hicham Berrada et Laurent Durupt
#Shake_Me par Frédéric Deslias
Num of the Moon par Dasniya Sommer

Conférences / Débat
Vers une culture expérientielle par Pascal Lebrun-Cordier

Concerts
Sandglasses par Juste Janulyte
• James ginzburg & MFO (Bleed Turquoise) + Roly Porter & MFO + Emptyset

Installations
#Softlove par Frédéric Deslias, Le Clair Obscur
Les Falaises de V par Laurent Bazin
Tracing Sites par Couch.

Ateliers
• Workshop sur la réalité virtuelle et le spectacle vivant

commentaires

EXPERIMENTA, la Biennale Arts Sciences 2018

Publié le 25 Janvier 2018 par Anaïs BERNARD dans exposit, festivals

EXPERIMENTA, la Biennale Arts Sciences 2018

Chaque édition d’EXPERIMENTA, la Biennale Arts Sciences est différente, évolution du contexte, évolution de nos partenariats... Mais une chose ne change pas, c’est l’urgence de comprendre ce qui advient, comprendre ce que l’espèce humaine est en train de faire, en train de se faire. En favorisant la rencontre entre artistes, scientifiques et technologues, ce qui nous importe, au fond, c’est d’œuvrer à la prise de conscience du devenir commun de l’humanité. L’homme est curieux par nature, son cerveau cherche le nouveau, il est impossible d’appuyer sur un bouton pour dire stop. Face aux multiples enjeux humains actuels les partenaires de cette biennale font le pari qu’il est possible de penser le futur et qu’il se pensera avec les arts (le regard poétique sur le monde), avec les sciences (le regard analytique et non superstitieux), avec les techniques (la manière d’être dans et avec l’univers). La première des techniques c’est le langage, la parole, la langue. Nous avons plus que jamais besoin de mettre des mots sur ce qui arrive. C’est notre mission d’acteur culturel du service public. Je suis toujours étonné de la richesse de ce que les équipes rassemblées ici sont capables de produire, de ce que nous sommes capables de vous offrir. Prenez le temps, profitez-en, partagez cette richesse, c’est une chance...

 

EXPERIMENTA, LA BIENNALE ARTS SCIENCES
DU 01 AU 10 FÉVRIER 2018
Un événement multiple pour agiter la curiosité !


• 12 spectacles dans 11 salles partenaires, de l’agglomération grenobloise
• 1 Salon Arts Sciences, tout public et gratuit, les 8, 9, 10 février à la Maison MINATEC - Grenoble
• 1 journée professionnelle : « Penser l’humain à l’heure de l’intelligence artificielle » (7 février)
• 12 tables rondes autour de la souveraineté du numérique, du low-tech, des rites et des technologies, de la réalité
virtuelle, des GAFA, de l’intelligence artificielle…
• 1 média Lab : un forme innovante de médiation et d’animation participative à vivre sur le temps du salon et sur les réseaux sociaux


EXPERIMENTA, la Biennale met en public l’art, la science et la technologie en train de s’inventer ensemble. Pierre angulaire de l’activité de l’Hexagone, EXPERIMENTA, la Biennale Arts Sciences coordonnée par la scène nationale est un rendez-vous articulé à partir d’une programmation de spectacles dans les salles partenaires, d’un salon et de tables rondes.
Durant 10 jours, EXPERIMENTA, la Biennale Arts Sciences crée l’événement en associant les artistes, les chercheurs, les entreprises, les citoyens à la co-construction d’un nouveau regard sur les questions de société à travers des œuvres au croisement des arts et des sciences.
Durant les 3 jours d’ouverture d’EXPERIMENTA le Salon Arts Sciences, les artistes, scientifiques, technologues et industriels transmettent leur démarche de création commune à travers des dispositifs artistiques et technologiques, des démonstrations techniques, des rencontres et des ateliers participatifs.


À vous d’explorer !

commentaires

Le congrès 2018 de la SIF : L’informatique au carrefour des sciences

Publié le 24 Janvier 2018 par Anaïs BERNARD dans conférence

Le congrès 2018 de la SIF : L’informatique au carrefour des sciences

MERCREDI 31 JANVIER 2018 À 13H30

CONFÉRENCES
L’informatique, science au cœur du numérique, bouleverse tous les pans de la société et notamment les sciences dites « traditionnelles ». Comment la science informatique et les autres sciences s’enrichissent-elles mutuellement et contribuent-elles chacune à l’émergence de nouvelles idées, de nouveaux concepts ? Comment engendrent-elles, ensemble,  de nouvelles disciplines (e.g. bioinformatique) ?  Comment travaillent-elles de concert pour modeler l’avenir de l’homme (agronomie, médecine, robotique…) ? Comment, enfin, la science informatique renouvelle-t-elle également le visage des sciences humaines ?  

 

Programme
13h30 - Ouverture 
Jean-Marc Petit, président de la Société informatique de France (SIF)
13h45 - Le geste médico-chirurgical assisté par ordinateur
Pierre Mozer, professeur des universités, praticien hospitalier, hôpital de la Pitié-Salpêtrière ;
Jocelyne Troccaz, directrice de recherche au CNRS, Laboratoire TIMC-IMAG, université de Grenoble Alpes - CNRS UMR 5525.
14h45 - La co-évolution des protéines et le monde des virus
Alessandra Carbone, professeur à l’université Pierre-et-Marie-Curie, membre senior de l’Institut universitaire de France ;
François-Loic Cosset, directeur de recherche au CNRS et directeur du Centre international de recherche en infectiologie, INSERM-CNRS, École normale supérieure de Lyon.
16h - Faire parler les murs : la restitution de la villa de Diomède à Pompéi
Hélène Dessales, maître de conférences en archéologie à l’École normale supérieure de Paris.
17h - Comment les grandes structures de l’univers se sont-elles formées ?
Éléments de réponse grâce à la simulation numérique
Romain Teyssier, professeur à l’université de Zürich, grand prix scientifique de la Fondation Simone et Cino del Duca – Institut de France.
18h30 - D’Hermès à Petite Poucette
Michel Serres, membre de l’Académie française, philosophe et historien des sciences.
19h15 - Remise des prix et proclamation des membres d'honneur
• Remise de prix du concours vidéo #ScienceInfoStream par le parrain du concours, Mounir Mahjoubi, Secrétaire d'État auprès du Premier ministre, chargé du numérique.
• Remise du prix de thèse Gilles Kahn à Amina Doumane ; accessits à Aurélien Cavelon et Wenjie Fang.
• Proclamation des membres d’honneur 2018 de la SIF : Claude Delobel, Hélène Kirchner, Eric Pilaud et Véronique Torner. 

En présence de :
Michel Bidoit, directeur CNRS/INS2I ;
Stéphane Fay, responsable de l'unité Informatique et sciences du numérique au Palais de la découverte ;
Mounir Majouhbi, Secrétaire d’État auprès du Premier Ministre, chargé du numérique ;
Antoine Petit, président directeur général de l’INRIA.

En savoir plus sur le congrès : societe-informatique-de-france.fr

Congrès organisé en partenariat avec la Société informatique de France, le CNRS INS2I et INRIA.

 
IMPORTANT : afin d'accéder à la salle de conférence, il est indispensable de retirer une contremarque à la borne d'accueil installée à l'entrée du Palais de la découverte (côté gauche).

commentaires

POÏÉTIQUES DU DESIGN 4 Conception, corps et fiction

Publié le 23 Janvier 2018 par Anaïs BERNARD dans ouvrage

POÏÉTIQUES DU DESIGN 4 Conception, corps et fiction

Au regard des trois précédents volets de "Poïétiques du design", ce quatrième recueil d'articles permet d'aborder la question de la conception au travers d'une relecture du corps et de nos capacités à nous aventurer dans certaines fictions. Les auteurs de cet ouvrage s'attachent à interroger la place du corps et de la fiction dans la conception en architecture et en design, et font état d'un transhumanisme croissant au niveau du corps, de la science, de l'industrie et de l'éthique.

Trois tomes de "Poïétiques du design" sont déjà parus aux Editions L'Harmattan : "Vers de nouveaux paradigmes de la conception ?" en 2014, "Eco-conception" puis "Conception et politique" en 2015.
Contributeurs : Pierre Litzler / Luis Miguel Pinto Gonçalves / Maxime Favard / Gwenaëlle Bertrand / Salomé Bour / Thomas Brunel / Florian Harmand.

 

Gwenaëlle Bertrand, Maxime Favard, 2017, Poïétiques de design 4, Conception, corps et fiction, Paris, L'Harmattan: Esthétique série Ars , 216 pages, 22,50 euros.

commentaires

Emprise

Publié le 22 Janvier 2018 par Anaïs BERNARD dans exposit, artiste

Emprise

Dans le cadre de la saison numérique N°2, le Département du Doubs, le Conservatoire à Rayonnement Départemental du Pays de Montbéliard et le Pavillon des sciences présentent "Emprise", une installation interactive sonore située dans l'espace d'exposition "Ombres et lumières".

Cette expérience numérique est proposée par le collectif L'Echo de Salma, Clément GERARD et Carine GERARD.

"Suis-je multiple? Suis-je seul? Suis-je seul acteur de mes décisions? Puis-je voir l'autre? Est-il étranger? Quelle est sa place dans mon existence? Est-il un miroir de mes peurs, de mes jugements? Un miroir de mes fantasmes? Si je ne suis pas seul, qui est l'autre? Est-ce moi?"

Emprise est un dispositif interactif et sonore qui propose de manipuler un concept d'influence. A travers, ce dispositif artistique, le spect-acteur pourra s'immerger un temps dans l'esprit de l'installation numérique et manipuler ses pensées en contrôlant les influences portées sur elle, mettant en évidence l'emprise qu'elle subit.

Le collectif L'Echo de Salma se donne pour objectif de créer des œuvres multi-médias accessibles à tous. En utilisant la technologie actuelle et en croisant des disciplines, des perspectives apparaissent pour créer des ouevres nouvelles, qu'elles soient virtuelles et accessibles sur internet, ou sous forme d'installations.

commentaires
<< < 10 20 30 40 50 60 70 80 90 91 92 93 94 95 96 97 98 99 100 200 > >>